| Issue |
BIO Web Conf.
Volume 41, 2021
The 4th International Conference on Bioinformatics, Biotechnology, and Biomedical Engineering (BioMIC 2021)
|
|
|---|---|---|
| Article Number | 06003 | |
| Number of page(s) | 6 | |
| Section | Biomolecular and Biotechnology | |
| DOI | https://doi.org/10.1051/bioconf/20214106003 | |
| Published online | 22 December 2021 | |
Molecular Identification of ABC2 Transporter Gene Encode Protein Ngawi Trypanosoma evansi Isolate that suspected resistance to Isometamidium Chloride
1
Master Program of Sain Veteriner, Faculty of Veterinary Medicine, Universitas Gadjah Mada, Yogyakarta, Indonesia.
2
Tropical Medicine, Medicine Faculty, Universitas Gadjah Mada, Yogyakarta, Indonesia
3
Biology Education Department, Faculty of Teacher Training and Education, Universitas Muhammadiyah Malang, Indonesia.
4
Departement of Parasitology, Faculty of Veterinary Medicine, Universitas Gadjah Mada. Yogyakarta, Indonesia.
* Corresponding author: wisnu-nc@ugm.ac.id
This study aims to determine the profile of the ABC2 encoding transporter on Trypanosoma evansi (T. evansi) Ngawi isolates, Indonesia, exposed with Isometamidium Chloride (ISM). This study used blood samples of mice containing Trypanosoma evansi that had been exposed with ISM 0.05 mg/kg BW, ISM 0.1 mg/kg BW and ISM 0.3 mg/kg BW for 4 weeks, and control group. Blood samples were extracted and amplified using primers. ABC2 F 5 ’GCTTGTCCGACCATCTTGCA 3’ and ABC2 R 5 ’AGGTCCACTCCCATGCTACA 3’ that produced 350 basepairs (bp). The sequencing results were then analyzed using BLAST and MEGA 7.0. There was 1 deference nucleotide (107) derived from multiple alignments, while in amino acids there was no difference in all samples. Trypanosoma evansi which was exposed with ISM does not have many differences in nucleotide or amino acid and only one type of mutation. The ABC2 Transporters of four groups of T.evansi have high similarity to ABC Transporters of T. brucei gambiense, T. brucei brucei, and T. brucei brucei (Tbabc2). Therefore, further research on the ABC2 Transporter gene is needed.
Key words: ABC2 Transporter Gene / Trypanosoma evansi / Isometamidium Chloride / resista nce
© The Authors, published by EDP Sciences, 2021
This is an Open Access article distributed under the terms of the Creative Commons Attribution License 4.0, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.
Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.
Initial download of the metrics may take a while.

