Open Access

Table 1

Comparing ITS sequence of C. caucasica with sequences of GeneBank.

Sequence 5’-3’ Accession Description % of identity
TGGGGTCGCGTTGGAGCGCCGAGTTAATGGCGCGATTGGGGGTCTCCGAGGGTCTCGCGACGTGCTAAAGCGCGCGCAACGGGGCACCGAATGCTCGACAACCACCGAATGTTGCGGCGCTCGCAACCGAGGACTCGTTTTTGGGCCAACCGCGAGGCTAATC MN381774.1 Celtis australis isolate Velzen, R. van 12, ITS1, partial sequence; 5.8S rRNA, ITS2, partial sequence 93.87
MN381773.1 Celtis bungeana isolate J_submit_003, ITS1, partial sequence; 5.8S rRNA gene, complete sequence; and ITS2, partial sequence 93.87

GCGCACGGGAGGCCAATTTCCGCCCCCGCCCGAACGCGCCCTCTCGGAGCGAGGTGCGGGGGGGGGGGACAATGTGTGACGCCCCCGCAGACGTGCCCCCCGCCTAATGGGTTCTGGGGCAACTTGTGTTCAAAAACTCGATGGTT MN381776.1 Celtis choseniana isolate J_submit_005, ITS1, partial sequence; 5.8S ribosomal RNA, ITS2, partial sequence 93.59

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.