| Issue |
BIO Web Conf.
Volume 31, 2021
VI International Scientific Conference “Problems of Industrial Botany of Industrially Developed Regions” 2021
|
|
|---|---|---|
| Article Number | 00009 | |
| Number of page(s) | 5 | |
| DOI | https://doi.org/10.1051/bioconf/20213100009 | |
| Published online | 13 August 2021 | |
Sequencing conserved region of endangered species Celtis caucasica Willd
1 Botanical garden of Nur-Sultan city, Biotechnology laboratory, 0100000, Nur-Sultan, Kazakhstan
2 Institute of Botany and Phytointroduction, Main Staff Department, 050040, Almaty, Kazakhstan
Abstract
The rarest species of relict ironwood C. caucasica Willd. is naturally occurred on the Ile-Alatau Mountains but very little is known about genetic diversity and distribution and size of its populations in Kazakhstan. In during the sampling expedition were found two additional plant populations in Dzungarian and Kyrgyz Alatau Ranges. The objective of this work was targeted towards sequencing ITS region of C. caucasica and compare the obtained nucleotide sequence with available data on NCBI GeneBank for confident species identification. The identity of C. caucasica sequence and available C. australis and C. bungeana sequences was 93.87% and less. It could be associated with absence sequences producing significant alignments with the studied ironwood sequence and important deposited sequences of GenBank lacking Latin binominals is from environmental samples. Clarifying taxonomical status species and subspecies is difficult by morphological data and molecular markers should be used to correct identifying an endangered species of C. caucasica growing in the east-southern and the south regions of Kazakhstan and providing direction to the conservation management of the plant.
© The Authors, published by EDP Sciences, 2021
This is an Open Access article distributed under the terms of the Creative Commons Attribution License 4.0, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
1 Introduction
Kazakhstan is the ninth largest country in the world in terms of its area, but more than 75% of its territory belongs to a dry arid zone with a sparsely wooded and treeless landscape. In general, there is 4.2-4.6% of the territories of the Republic covered by the forest [1, 2]. So, the creation of tree plantations on the territory of forest-deficient regions is of great ecological importance.
Kazakhstan’s flora contains more than 5754 species of vascular plants [2, 3]. Among them, 68 arboreal, 226 shrub and 433 semi-shrub plant species are naturally occurred. Studying a natural genetic diversity of dendroflora has great practical issue and allow to increase and to improve species content of green plantings, and find resistant genotypes and new deciduous ornamental trees for city environments [4].
One of recommended species for particulate capturing in the big megapolis could be nettle tree (Celtis australis) because of its rough leaf surface [5]. Although, certain species featuring small leaf surface (needles), for instance the Scots pine Pinus sylvestris L. is the most common plants used for larger forestation. The three species of conifers P. sylvestris
L., Juniperus communis L. and Picea abies L. (Karst.) are used mainly in the landscaping of Moscow [6]. In Moscow, 366 species and forms of woody plants used in different types of urban plantings have been identified [4]. Whereas the assortment of woody plants in Rostov-on-Don, belonging to the steppe zone of Russia, consists of 211 species, one of which is the widespread C. occidentalis L. (Northern Hackberry, American Hackberry, Common Hackberry). It is considered that the American Hackberry is an introduced species in Ukraine, the North Caucasus and Russia [7]. An analysis of the collection in the Donetsk Botanical Garden (DBS) showed a tendency to run wild and spontaneous distribution of more than 40 tree species, including C. occidentalis L. [8].
The Hackberry is also found in the walnut forests of the Western Tien Shan belonging to the territory of the Central Asian states [9, 10]. In Kazakhstan, the rarest species of relict ironwood (Caucasian Hackberry) C. caucasica Willd. (1806) was collected by geobotanist, academician B.A. Bykov in the Ile-Alatau State National Natural Park (SNNP). It was accepted that C. caucasica has the northern border of distribution in the Dzungarian Alatau [11, 12].
The objective of this work was targeted towards sequencing ITS region of C. caucasica and compare the obtained nucleotide sequence with available data on NCBI GeneBank for confident species identification.
2 Materials and Methods
2.1 The collection of samples and DNA isolation
Plant samples of C. caucasica collected from populations locating in the mountain ravine of Major Almatynka near Almaty city. Genomic plant DNA isolation is provided from young fresh collected leaves samples in 3-5 repeats using the commercially available kit DNeasy Plant MiniKit (Qiagen, #69104). The quality of DNA samples were visual evaluated by using an electrophoresis technique and 0.9% agarose-gel containing ethidium bromide.
2.2 DNA amplification
The ITS region was amplified on the thermocycler Mastercycler pro (Eppendorf) with using universal specific primer pair ITS1-F 5’- TCCGTAGGTGAaCcTgCGg and ITS4- R 5’- TCCTCCGCTTATTGATATGC (White et al., 1990). The PCRs were performed in volume of 25 ul and contain 2.5μl of 10 × dNTPs (2 mmol/l each nucleotide), 2.5μl of 10× PCR buffer, 2.5μl of 25mM Mg2+, 1U of Taq DNA polymerase (ThermoScientific), 0.5 μl of 10 pmol/μl each primer and 5 μl of DNA target (0,02 μg/μl). PCR programme was 95°C for 5 min, followed by 35 cycles of 30 sec at 94°C, 40 sec at 58°C and 50 sec at 72°C, with a final elongation step of 7 min at 72°C. The PCR products were examined via electrophoresis in 1.2% TAE-agarose gel and ChemiDoc XRS+ (BioRad, USA).
2.3 Sequencing and analysis
According to manufacturer’s protocol the PCR products were purified by using Exonuclease I (Fermentas) и phosphatase (Fastap, Fermentas). Sequencing reactions were done with BigDye terminator v3.1 sequencing kit and DNA fragments were fractionated on 3730x1 DNA analyzer (Applied Biosystems, USA). Obtained nucleotide sequences were analyzed by SeqMan (Applied Biosystems). To identify plant species, the nucleotide sequence was compared with the nucleotide sequences available through international databases GenBank (http://blast.ncbi.nlm.nih.gov/Blast.cgi).
3 Results and discussion
Apart of preliminary C. caucasica surveys, very little is known about genetic diversity and distribution and size of its populations. Since XIX century the territory of the Ile-Alatau State National Natural Park (SNNP) belonged to Ile-Alatau Mountains was well known as a range and habitat for the hackberry (ironwood) in Kazakhstan. Biological properties and characteristics of this population of C. caucasica is well studied and shown that is growing on 1400 meters of elevation where is occurred a deciduous forest, cereal grasses and shrubs [13].
There is less information about other populations of C. caucasica that we met on the mountain passageway called Arkharly belonging to Dzungarian Alatau Range as seen on the figure (cycled area). On the figure is shown a map created via GoogleMyMap (https://www.google.com/maps/) and there is an area of Kyrgyz Alatau having opposite direction from Almaty city to Dzungarian Alatau Range. The studied populations of C. caucasica from Kyrgyz Alatau Range is distributed on the mountain ravine of Merki near with same named city and located more than 370 km far from Almaty city.
In all eukaryotic kingdoms, internal transcribed spacer (ITS) region is applicable for identification of the broadest possible taxonomic groups. On the table 1 showed the obtained nucleotide ITS sequence for C. caucasica comparing with genome sequences available in GenBank database.
As seen on table 1, the identity of C. caucasica sequence and available C. australis and C. bungeana sequences was 93.87% and less. It could be associated with absence sequences producing significant alignments with the studied ironwood sequence and important deposited sequences of GenBank lacking Latin binominals is from environmental samples.
The taxonomists have questioned with reliable identification of the plant species as well as resolving problems around Celtis spp. hybridizations [14]. Previously Celtis genus was included to the family of Ulmaceae Mirb. s.s.and then to separate Celtidaceae Link but due to phylogenetic studies the APG III system places it in the family Cannabaceae [15]. S.K. Czerepanov reported 5 hackberry species C. australis L. (Mediterranean hackberry, European nettle tree, lote tree), C. caucasica Willd., C. glabrata Stev ex Planch, C. tournefortii Lam. (C. aspera (Ledeb.) Stev.) and C. tupalangi Vass. [16]. However now the genus consists of about 70 species where C. caucasica has five synonyms C. arcata Buch.- Ham. ex Wall., C. australis ssp. caucasica (Willd.) C.C. Townsend, C. caucasica ssp. caudata (Planch.) Grudz. and C. tupalangi Vass.
Depending on taxa, ITS can had the most resolving or lower power for species discrimination than other nuclear ribosomal markers such as SSU (18S nuclear ribosomal small subunit rRNA gene) and LSU (28S nuclear ribosomal large subunit rRNA gene). Microsatellite markers have found to be ideal for plant studies. SSRs are extremely useful to assess levels of genetic similarity among closely related species, to quantify a diversity and estimate the degree of relatedness amongst different populations and between genotypes [17]. Clarifying taxonomical status species and subspecies is difficult by morphological data and molecular markers should be used to correct identifying an endangered species of C. caucasica growing in the east-southern and the south regions of Kazakhstan and providing direction to the conservation management.
![]() |
Fig. 1 Geographic map of Celtis caucasica populations. |
Comparing ITS sequence of C. caucasica with sequences of GeneBank.
References
- N.K. Chebotko C.V. Malovik, “Floristic composition of introduced species in the dendropark and arboretum of the LLP KazNIILH (North Kazakhstan)”, Proceedings of the Internat. conf. Assessment, Conservation and Sustainable Use of Plant Biological Diversity, 2012, Minsk. [Google Scholar]
- The Fifth National Report on progress in implementation of the Convention on Biological Diversity (2014) [Google Scholar]
- K. Tayjanov, N.Z. Mamadalieva, and M. Wink, Diversity of the Mountain Flora of Central Asia with Emphasis on Alkaloid-Producing Plants, Divers. J., 9, 11, (2017) [Google Scholar]
- L.S. Plotnikova, “The development of the dendrological research in the Main Botanical garden named N.V. Cicin RAS”. Materials of the International Scientific Conference the Problems of Modern Dendrology, 2009, Moscow. [Google Scholar]
- C.C. Guerrero Urban tree and atmospheric pollutants in big cities: Effects in Madrid. Thesis doctoral, Madrid, 2014. [Google Scholar]
- M.S. Alexandrova. “Decorative coniferous forms to enrich the collection of the Main Botanical Garden RAS”. Materials of the International Scientific Conference the Problems of Modern Dendrology. Proceedings, 2009, Moscow. [Google Scholar]
- P.N. Lapin, K.K. Kalutsky, O.N. Kalutskaya. Introduction of forest species, (Moscow 1979) [Google Scholar]
- R.I. Burda Introduction of plants: Domestication and naturalization, Ind. Bot., 13: 3–15 (2013) [Google Scholar]
- E.A. Butkov, “Conservation of walnut forests in Uzbekistan”, Proceedings of Internat. Sci. and Pract. Conf. Preservation and sustainable using the biodiversity of fruit cultures and their wild pedigrees, 2011, Tashkent. [Google Scholar]
- E. Cantarello, A. Lovegrove, A. Orozumbekov, J. Birch, N. Brouwers, A.C. Newton. Human Impacts on Forest Biodiversity in Protected Walnut-Fruit Forests in Kyrgyzstan. J. Sustain. For., 33:454–481 (2014) [Google Scholar]
- A.A. Ivashenko, R.M. Turchanova, Materials of Ile-Alatau National Park, (Astana: Zhasyl Orda, 2015) [Google Scholar]
- R.V. Jashenko. Strict nature reserves of Central Asia. Nature protected areas of Central Asia, (Alma-Ata, 2006) [Google Scholar]
- R.M. Turehanova, A.A. Ivashhenko, A.A. Zhaksylykova, Fruiting dynamics of major trees and shrubs in Ile-Alatau National Park, KazNU Bulletin. Biology series. 3/2(59): 543–546 (2013) [Google Scholar]
- T.S.M.A. El-Alfy, H.M.A. El-Gohary, N.M. Sokkar, S.A. El-Tawab, D.A.M. Al-Mahdy, Botanical and genetic characteristics of Celtis australis L. and Celtis occidentalis L. grown in Egypt, Bull. Fac. Pharm. Cairo Univ., 49: 37–57 (2011) [Google Scholar]
- “An update of the Angiosperm Phylogeny Group classification for the orders and families offlowering plants: APGIII”. Bot. J. Linn. Soc., 161(2): 399–436 (2009) [Google Scholar]
- S.K. Czerepanov, Vascular plants of Russia and adjacent states, (SPb.: Peace and family, 1995) [Google Scholar]
- A. Hayes, “The genetic structure of Celtis tenuifolia and comparisons to the related species C. occidentalis, and C. laevigata: Implications for the conservation management of threatened populations in Southern Ontario”. Thesis M. of Science in Biology (Carleton University Ottawa, Ontario, 2019) [Google Scholar]
All Tables
All Figures
![]() |
Fig. 1 Geographic map of Celtis caucasica populations. |
| In the text | |
Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.
Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.
Initial download of the metrics may take a while.


